GENOME EXPLORER

The 3D Secret Recipe of Life

Mitochondria

The power plant of the cell, making ATP energy.

Fun fact goes here.

THE GENOME SEQUENCING LAB BENCH

Follow the 6 real laboratory steps to sequence, assemble, and decode the creature's genome!

๐Ÿงช Test tube ready. Step 1: Add Soap & Salt to dissolve the cell membranes!

Step 1: Cell Lysis & DNA Extraction

To read DNA, we first have to free it from inside millions of cells! Just like in a real kitchen strawberry DNA extraction, soap dissolves the fatty cell membrane, and alcohol makes the DNA float up.

1
Add Soap & Salt Lysis Buffer
Soap cuts through the fatty lipid membranes and salt helps DNA clump together.
2
Pour Chilled Ethanol
DNA cannot stay dissolved in ice-cold alcohol! It precipitates out into cloudy white strings.
3
Twirl the Glass Rod
Spool up the pure genomic DNA threads like cotton candy!

Step 2: The Fragmentation Station (Why We Chop)

The Big Problem: High-speed sequencing machines can only read 150 to 300 letters at a time. An uncut 3-billion-letter chromosome is like a 10-mile-long scroll!
The Solution: Shotgun sequencing! We shatter the long strand into thousands of short overlapping puzzle fragments.

Ready to fragment. Click the button above to focus acoustic soundwaves through the water bath!
ATGCAATGCCTTAGACCTATAAAGTAAATGCAATGCCTTAGACCTATAAAGTAAATGCAATGCCTTAGACCTATAAAGTAA
Overlapping Short-Read Library (Fragment Pile):
No fragments yet. Click 'Send Ultrasonic Sonic Pulse' above!

Step 3: Sequencing by Synthesis

Inside the flowcell chip, polymerase adds fluorescent-tagged letters. Each base flashes its own color under a laser!

๐Ÿ”ฌโšก
High-Resolution Optical Camera
Detecting A (Green), T (Red), C (Cyan), G (Gold)
FASTQ STREAM TERMINAL LIVE FEED
Ready. Click 'Start Sequencing Laser Scan' to watch base calls generate live!

Step 4: The Great Jigsaw Puzzle (De Novo Assembly)

Match the overlapping ends of each read to reconstruct the full genome sentence!

Coverage Depth:
Target Assembly Rail: Drag matching reads here or click reads in the tray below!
๐Ÿ‘‰ Start by finding the read that begins with the start letters: ATG!
Unplaced Fragment Tray:
Empty Assembly Rail โ€” Drag reads above to begin matching!
โš™๏ธ Molecular Ribosome Machine

Step 5: Decoding the Gene

The letters in DNA are read in 3-letter words called CODONS. Each codon calls for a specific amino acid bead. String them together, and they fold into a working 3D protein!

Waiting for Translation...
Click 'Translate Gene into Protein' to watch the ribosome read the codons and fold the polypeptide chain!

Step 6: The Mutation Sandbox (Nature's Variations)

What happens when a single letter changes? Click on any letter in the gene below to test how mutations shape living things!

Select a Base Above to Mutate
Mutations are nature's experiments. They can be silent (doing the exact same thing), create exciting physical variations (like different coat colors), or interrupt instructions.
Creature Outcome:
Click codon #4 (CTT) for a Silent Mutation, codon #2 (CAA) for a Trait Variation, or codon #9 for a Stop Mutation!
๐Ÿ†

GENOME ASSEMBLED!

Hooray! You matched all the overlapping reads, resolved every puzzle piece, and reconstructed the complete genomic sequence!